Make sure you check out the link at the bottom of this post!
All of the cells in your body have the same DNA, or instructions. So why do we have over 200 different types of cells if they all have the same 
instructions? Cells can turn genes (small stretches of DNA) on or off, allowing the cells to differentiate, or become different types of cells.
This sounds relatively straightforward; however, it brings us to another question. What does it mean to “turn on” a gene? When your cell turns on a gene, it takes the message in the DNA code and turns it into an RNA code. This process is called transcription and is like copying a recipe from a book. The mRNA leaves the nucleus and travels to the ribosome. Once at the ribosome, the mRNA is read 3 letters at a time. Each group of 3 letters is a codon that tells the ribosome which amino acid to add. The chain of amino acids folds into a specific shape to make a protein with a specific function.
So let’s say you look at a piece of DNA from a liver cell and a skin cell. Both of the cells have the DNA sequence below, but the liver cell uses the green gene and the skin cell uses the blue gene.
DNA: AACATACTTTTCTCTCCTATCTCTCATTCGCTCGGGCTCTCTCGCTTACATCACGTCAGCTATT
Gene used by liver cell Gene used by skin cell
mRNA: AUGAAAAGAGAGGAUAGAGAGUAA AUGUAGUGCAGUCGAUAA
Notice that each of these genes begin with AUG (which tells the ribosome to start building) and they end with UAA (which tells the ribosome to stop building). These two different mRNA molecules will instruct ribosomes to build two different proteins that have different functions, which will help make these cells different.
Universal Codon-Amino Acid Table
To use the table:
1) Start on the left part of the table.
2) Find the first letter of your RNA triplet and put a finger on it.
3) Find the second letter on the top of the table and put your other finger on that.
4) Now drag your fingers to where they meet and look for the third letter.
5) Write down the 3 letter abbreviation for the amino acid.
For extra practice, visit the following link, which has a very good interactive example of protein synthesis: http://learn.genetics.utah.edu/content/begin/dna/transcribe/. As always, my door is always open if you want help or extra practice.
